15 folds Study guides, Class notes & Summaries

ATI MATERNAL NEWBORN PROCTORED EXAM REVIEW (2022/2023) A nurse is caring for a client who is at 32 wks gestation and is experiencing preterm labor. What meds should the nurse plan to administer? a. misoprostol b. betamethasone c. poractant alfa d. methylergonovine Correct Answer: b. betamethasone A nurse at a prenatal clinic is caring for a client who suspects she may be pregnant and asks the nurse how the provider will confirm her pregnancy. The nurse should inform the client that what...

Portage Learning CHEM 210 exams 1-8 and final exam Question 1 3 / 3 pts True or False: According to the Module, a compound with a molecular mass of 1,000 g/mol is considered a macromolecule. True Correct! False Question 2 3 / 3 pts True or False: Biomolecules can have only two functional groups. True Correct! False Question 3 3 / 3 pts True or False: The following functional group is an alcohol. True Correct! False Question 4 3 / 3 pts True or False: In ...

MN 551 Midterm Exam 2023/2024 Saved A patient is experiencing impaired circulation secondary to increased systemic arterial pressure. Which of the following statements is the most relevant phenomenon? Question 1 options: Increased preload due to vascular resistance High afterload because of backpressure against the left ventricle Impaired contractility due to aortic resistance Systolic impairment because of arterial stenosis Question 2 (2 points) Saved A nurse practitioner employe...

PN maternal newborn online practice 2023 A Questions and Answers 100% correct A nurse is caring for a client who is at 11 weeks of gestation and reports frequent vomiting. Which of the following findings should the nurse identify as an indication that the client has hyperemesis gravidarum? Ketonuria Bradycardia Bradypnea Proteinuria Ketonuria A nurse is collecting data from a client who is at 36 weeks gestation during a prenatal examination. Which of the following findings shou...

NRNP 6531 Midterm Exam 2022 Review Test Submission What is the Gold standard for the diagnosis of asthma?  Question 3 1 out of 1 points Which of the following is not a goal of treatment for the patient with cystic fibrosis?  Question 4 0 out of 1 points An 18 year old basketball player complains of itching in the crural folds, buttocks, and upper thighs. The lesions are well demarcated and are half-moon shaped. The area is red, irritated, and there are small breaks in the skin fro...

Test bank of tymoczkos biochemistry a short course 3rd edition Chapter 1 Biochemistry and the Unity of Life Matching Questions Use the following to answer questions 1–10: Choose the correct answer from the list below. Not all of the answers will be used. a) uracil b) cytoplasm c) protein d) thymine e) carbohydrate f) sugar–phosphate units g) cell wall h) transcription i) glycogen j) lipid k) central dogma l) phagocytosis m) endoplasmic reticulum n) translation o)...

2023 MATERNITY/OB PN HESI SPECIALITY V1 1) At 14-weeks gestation, a client arrives at the Emergency Center complaining of a dull pain in the right lower quadrant of her abdomen. The LPN/LVN obtains a blood sample and initiates an IV. Thirty minutes after admission, the client reports feeling a sharp abdominal pain and a shoulder pain. Assessment findings include diaphoresis, a heart rate of 120 beats/minute, and a blood pressure of 86/48. Which action should the nurse implement next? ...

Question 1 [15] Describe and illustrate how you could differentiate between these four DNA strands, using DNA melting experiments: Strand 1: 5ʹATTTTAAATTAGCATTTAAT3ʹ Strand 2: 5ʹATGCCGATATTTTTAGCGCA3ʹ Strand 3: 5ʹAGCGGGGCGGCAGCGCGGAT3ʹ Strand 4: 5ʹAGCGGGGCGGCAGCGCGGATA3ʹ Question 2 [10] Your friend studying computer science is designing a new protein folding tool that will predict protein folding pathways. Explain to them, using your UNISA BCH3703 module content, why a particul...

COMD 5070 Exam 2 (Latest 2023/ 2024 Update) Acoustics of Speech and Hearing| Questions and Verified Answers| 100% Correct| Grade A Q: what is subglottal pressure? Answer: P⌄sub -pressure below the larynx -driving pressure for phonation Q: what are some direct ways to measure subglottal pressure? Answer: -tracheal puncture -esophageal pressure Q: how can you measure subglottal pressure? Answer: there are both direct (tracheal puncture and esophageal ball...

ANCC IQ Domain • Domain 1: Scientific Foundation (40 questions with rationales) • Domain 2: Advanced Practice Skills (49 questions with rationales) • Domain 3: Diagnosis and Treatment (52 questions with rationales) • Domain 4: Psychotherapy and Related Theories (30 questions with rationales) • Domain 5: Ethical and Legal Principles (72 questions with rationales) ANCC Domain 1: Scientific Foundation (40 questions with rationales) As a PMHNP, you are aware of antipsychotic medic...